Catalogue - T-DNA lines

About 55,000 T-DNA insertion mutant lines have been generated in the Ws (Wassilewskija) background, so use Ws, not Col-0, as a control for genotyping and phenotyping. The vector used for plant transformation contains genes conferring kanamycin and Basta (phosphinothricin) resistance as plant selection markers. For each line, T3 seeds produced from the bulk of about 50 T2 plants are distributed. A seed batch thus contains individuals homozygous for the T-DNA insertion, individuals hemizygous for the T-DNA insertion and wild-type individuals.
Genomic sequences flanking the T-DNA insertions (FST: Flanking Sequence Tags) have been determined for all the T-DNA lines. 46,236 flanking sequence tags (FST) have been identified, they are available in the database Flagdb++, as well as SIGnAL and TAIR.
T-DNA lines are genetically modified organisms (GMO): you must have the appropriate authorization to receive and handle GMOs.

'Search' function: you can search for an insertion line from its name, for example CPK20, or from the name of the FST, for example 629A04 (not FLAG_629A04). If you enter 'ABC', you will get all items whose name starts with 'ABC'. It is also possible to enter comma-separated lists (for example CPK20,DRB14,DTX127).

To confirm a T-DNA insertion, PCR amplify the genomic DNA of the mutant line using one primer from the T-DNA border and one primer specific to the genomic sequence. Since rearrangements occur during the translocation event, it is important that gene specific primers are designed directly from the FST.
If the FST was amplified with the right border (RB) of the T-DNA, you can use the primers
Tag3: CTGATACCAGACGTTGCCCGCATAA
or RB4: TCACGGGTTGGGGTTTCTACAGGAC
If the FST was amplified with the left border (LB) of the T-DNA, you can use the primers
Tag5: CTACAAATTGCCTTTTCTTATCGAC
or LB4: CGTGTGCCAGGTGCCCACGGAATAGT